Top » Catalog » SNPs » FGC19425

$18.00

FGC19425
[FGC19425]

FGC19425
hg38 Position: ChrY:10109303..10109303
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19425_F GGCATCCCTATCTTCTGTCG
Reverse Primer: FGC19425_R GCCAGCATCATCCTGAGAG
Reviews

Customers who bought this product also purchased
FGC23333
FGC23333
FGC32881
FGC32881
FGC19433
FGC19433
FGC23338
FGC23338
FGC33208
FGC33208
FGC19447
FGC19447
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies