Top » Catalog » SNPs » FGC19428

$18.00

FGC19428
[FGC19428]

FGC19428
hg38 Position: ChrY:11880318..11880318
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch; Same position as P202 but different base change
Forward Primer: FGC19428_F GGATAAGGACACATATATGCGG
Reverse Primer: FGC19428_R CAGAGTTGAACTATAGATTATCCTTATATCTCC
Reviews

Customers who bought this product also purchased
FGC23335
FGC23335
FGC19429
FGC19429
FGC31784
FGC31784
FGC19451
FGC19451
FGC33210
FGC33210
FGC23334
FGC23334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies