Top » Catalog » SNPs » FGC19433

$18.00

FGC19433
[FGC19433]

FGC19433
hg38 Position: ChrY:12626166..12626166
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19433_F TCCTGCCTAATTGCCCCA
Reverse Primer: FGC19433_R GTGAAAATCCTCAAGAAAACGG
Reviews

Customers who bought this product also purchased
FGC19446
FGC19446
FGC31786
FGC31786
FGC33213
FGC33213
FGC23331
FGC23331
FGC32879
FGC32879
FGC19428
FGC19428
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies