Top » Catalog » SNPs » FGC19434

$18.00

FGC19434
[FGC19434]

FGC19434
hg38 Position: ChrY:12852473..12852473
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19434_F CACTTGATCCAAGTGGCTATTC
Reverse Primer: FGC19434_R CCAGAGCAGAAAAGCTGAACAC
Reviews

Customers who bought this product also purchased
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33267
FGC33267
FGC33265
FGC33265
FGC39789
FGC39789
FGC39788
FGC39788
FGC39790
FGC39790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies