Top » Catalog » SNPs » FGC19435

$18.00

FGC19435
[FGC19435]

FGC19435
hg38 Position: ChrY:13071938..13071938
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19435_F TGGTTCATCTCACTGATACTAGTCAG
Reverse Primer: FGC19435_R CAGGCAGTCAGGCCTCAG
Reviews

Customers who bought this product also purchased
FGC33212
FGC33212
FGC23331
FGC23331
FGC23336
FGC23336
FGC31785
FGC31785
FGC19433
FGC19433
FGC33211
FGC33211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4588
$18.00
Haplogroup Info
Other products
Currencies