Top » Catalog » SNPs » FGC19435

$18.00

FGC19435
[FGC19435]

FGC19435
hg38 Position: ChrY:13071938..13071938
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19435_F TGGTTCATCTCACTGATACTAGTCAG
Reverse Primer: FGC19435_R CAGGCAGTCAGGCCTCAG
Reviews

Customers who bought this product also purchased
FGC23338
FGC23338
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC19446
FGC19446
FGC31787
FGC31787
FGC23332
FGC23332
FGC33213
FGC33213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies