Top » Catalog » SNPs » FGC19446

$18.00

FGC19446
[FGC19446]

FGC19446
hg38 Position: ChrY:16625159..16625159
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19446_F TGTCCACTTTCTCCTCATTCC
Reverse Primer: FGC19446_R TTCATTGAATCAAAGTCCTTACAG
Reviews

Customers who bought this product also purchased
FGC19454
FGC19454
FGC32877
FGC32877
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23334
FGC23334
FGC32882
FGC32882
FGC19433
FGC19433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies