Top » Catalog » SNPs » FGC19447

$18.00

FGC19447
[FGC19447]

FGC19447
hg38 Position: ChrY:16951527..16951527
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19447_F CAGACTAACAGCAAATCTCTCAGG
Reverse Primer: FGC19447_R CTTTTATTTTGAGGCTATGTGCC
Reviews

Customers who bought this product also purchased
FGC23331
FGC23331
FGC32879
FGC32879
FGC19428
FGC19428
FGC23336
FGC23336
FGC32884
FGC32884
FGC19435
FGC19435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies