Top » Catalog » SNPs » FGC19451

$18.00

FGC19451
[FGC19451]

FGC19451
hg38 Position: ChrY:18967770..18967770
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19451_F GAAGGAAGATGGGTCCAGTG
Reverse Primer: FGC19451_R ATGTGTTGCTAGGCCCTTTG
Reviews

Customers who bought this product also purchased
FGC19429
FGC19429
FGC23337
FGC23337
FGC32885
FGC32885
FGC19440
FGC19440
FGC31786
FGC31786
FGC33213
FGC33213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies