Top » Catalog » SNPs » FGC19451

$18.00

FGC19451
[FGC19451]

FGC19451
hg38 Position: ChrY:18967770..18967770
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19451_F GAAGGAAGATGGGTCCAGTG
Reverse Primer: FGC19451_R ATGTGTTGCTAGGCCCTTTG
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23334
FGC23334
FGC32882
FGC32882
FGC19433
FGC19433
FGC23339
FGC23339
FGC33210
FGC33210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies