Top » Catalog » SNPs » FGC19454

$18.00

FGC19454
[FGC19454]

FGC19454
hg38 Position: ChrY:20649486..20649486
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19454_F CAGCACCTGTCACCTGGA
Reverse Primer: FGC19454_R CAGTTGCCAGTCCTCAATCTTAC
Reviews

Customers who bought this product also purchased
FGC19451
FGC19451
FGC33210
FGC33210
FGC23334
FGC23334
FGC19425
FGC19425
FGC23339
FGC23339
FGC19447
FGC19447
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies