Top » Catalog » SNPs » FGC19454

$18.00

FGC19454
[FGC19454]

FGC19454
hg38 Position: ChrY:20649486..20649486
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19454_F CAGCACCTGTCACCTGGA
Reverse Primer: FGC19454_R CAGTTGCCAGTCCTCAATCTTAC
Reviews

Customers who bought this product also purchased
FGC19425
FGC19425
FGC23339
FGC23339
FGC19447
FGC19447
FGC33208
FGC33208
FGC23333
FGC23333
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies