Top » Catalog » SNPs » FGC19454

$18.00

FGC19454
[FGC19454]

FGC19454
hg38 Position: ChrY:20649486..20649486
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19454_F CAGCACCTGTCACCTGGA
Reverse Primer: FGC19454_R CAGTTGCCAGTCCTCAATCTTAC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
S1051
S1051
FGC17866
FGC17866
DF13
DF13
Z251
Z251
FGC17907
FGC17907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies