Top » Catalog » SNPs » S1046

$18.00

S1046
[S1046]

S1046
hg38 Position: ChrY:12845209..12845209
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S1046v2_F CTGTCTATAACGTAGAATGGCTTACG
Reverse Primer: S1046v2_R CAAATGATTTTAGATGATTCCAAATTC
Reviews

Customers who bought this product also purchased
FGC17991
FGC17991
S1047
S1047
FGC17982
FGC17982
FGC17990
FGC17990
S1041
S1041
FGC17981
FGC17981
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies