Top » Catalog » SNPs » S1047

$18.00

S1047
[S1047]

S1047
hg38 Position: ChrY:12885858..12885858
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1050
Forward Primer: S1047_F TTCTTCCTCTATGGAGTCTTTCC
Reverse Primer: S1047_R AAACAAGTAGCAAAATGACAGAGG
Reviews

Customers who bought this product also purchased
Z8425
Z8425
S16264
S16264
Z16500
Z16500
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC17906
FGC17906
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies