Top » Catalog » SNPs » S1047

$18.00

S1047
[S1047]

S1047
hg38 Position: ChrY:12885858..12885858
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1050
Forward Primer: S1047_F TTCTTCCTCTATGGAGTCTTTCC
Reverse Primer: S1047_R AAACAAGTAGCAAAATGACAGAGG
Reviews

Customers who bought this product also purchased
Z8425
Z8425
S16264
S16264
Z16500
Z16500
L1335
L1335
FGC10059
FGC10059
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies