Top » Catalog » SNPs » S1048

$18.00

S1048
[S1048]

S1048
hg38 Position: ChrY:13371656..13371656
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S1048_F TCAGTTACCCACATGCAAATG
Reverse Primer: S1048_R TCATCCCCATACCCCTACAAC
Reviews

Customers who bought this product also purchased
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
S1047
S1047
FGC17983
FGC17983
FGC17991
FGC17991
S1046
S1046
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies