Top » Catalog » SNPs » S1057

$18.00

S1057
[S1057]

S1057
hg38 Position: ChrY:16434687..16434687
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S1057_F TGGGAGGTTGAGCTACCG
Reverse Primer: S1057_R TTTCTAACTTATCCCAAGGAGTGC
Reviews

Customers who bought this product also purchased
S1047
S1047
FGC17983
FGC17983
FGC17991
FGC17991
S1046
S1046
FGC17982
FGC17982
FGC17990
FGC17990
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies