Top » Catalog » SNPs » Z16502

$18.00

Z16502
[Z16502]

Z16502
hg38 Position: ChrY:2831784..2831784
Ancestral: T
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Below DF13
Forward Primer: Z16502_F GAACGGCATTACATAACGGG
Reverse Primer: Z16502_R AACTTATTTTAACAATTATTTAGAGTTTTCAGTG
Reviews

Customers who bought this product also purchased
L1444
L1444
BY211577
BY211577
M7884
M7884
FT416429
FT416429
Z17653
Z17653
Y96923
Y96923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies