Top » Catalog » SNPs » Z17815

$18.00

Z17815
[Z17815]

Z17815
hg38 Position: ChrY:20588666..20588666
Ancestral: T
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a2a
Comments: Below R-L193
Forward Primer: Z17815_F ACTGGCAGTTTTCATTTAAGCAG
Reverse Primer: Z17815_R CCCAAGTAATGAAAGCGAAAC
Reviews

Customers who bought this product also purchased
Z17294
Z17294
Z17296
Z17296
Z16340
Z16340
FGC32837
FGC32837
Z39589
Z39589
FGC32836
FGC32836
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies