Top » Catalog » SNPs » CTS8816

$18.00

CTS8816
[CTS8816]

CTS8816
hg38 Position: ChrY:16111605..16111605
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a-Z280 not listed
Comments: Extracted from 1000 genomes data. Downstream Z280
Forward Primer: CTS8816_F CTAAGTCATGAAGCTTATTGTTGTC
Reverse Primer: CTS8816_R CCAGGCTGCTCATGTCTTCCTAACTG
Reviews

Customers who bought this product also purchased
YP4336
YP4336
YP6012
YP6012
R1a-Z93 Panel
R1a-Z93 Panel
M417
M417
L657
L657
Z2124
Z2124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies