Top » Catalog » SNPs » Z16980

$18.00

Z16980
[Z16980]

Z16980
hg38 Position: ChrY:21224405..21224405
Ancestral: T
Derived: C
Reference: Lawrence Mayka (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Downstream of L1025
Forward Primer: Z16980_F TGTTTTACTTACTGTGGCTCAGG
Reverse Primer: Z16980_R GACACAAATCTGAAACAGTAAACAATC
Reviews

Customers who bought this product also purchased
Y6075
Y6075
A15642
A15642
BY32560
BY32560
CTS10760
CTS10760
Y62942
Y62942
Y155153
Y155153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies