Top » Catalog » SNPs » A577

$18.00

A577
[A577]

A577
hg38 Position: ChrY:7962291..7962291
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: A577_F GTTTCAGGGAGGCTCCCTAG
Reverse Primer: A577_R AAGCTTACAGAAATTTGCAGCAG
Reviews

Customers who bought this product also purchased
BY111953
BY111953
I2 Superclade Panel
I2 Superclade Panel
Y177575
Y177575
M253
M253
Y125026
Y125026
Z59
Z59
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies