Top » Catalog » SNPs » DF21

$18.00

DF21
[DF21]

DF21
hg38 Position: ChrY:10041306..10041306
Ancestral: C
Derived: T
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g
Comments: Beneath R-L21. upstream of DF5. Aka. rs138322855
Forward Primer: DF21_F TGTTGGCATCTTTACTACATCTGTATG
Reverse Primer: DF21_R AACCTGTGAAGAGTTAGATGTGACA
Reviews

Customers who bought this product also purchased
CTS5396
CTS5396
L1065
L1065
A7907
A7907
FGC12428
FGC12428
M173
M173
Y3550
Y3550
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies