Top » Catalog » SNPs » DF21

$18.00

DF21
[DF21]

DF21
hg38 Position: ChrY:10041306..10041306
Ancestral: C
Derived: T
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g
Comments: Beneath R-L21. upstream of DF5. Aka. rs138322855
Forward Primer: DF21_F TGTTGGCATCTTTACTACATCTGTATG
Reverse Primer: DF21_R AACCTGTGAAGAGTTAGATGTGACA
Reviews

Customers who bought this product also purchased
BY23383
BY23383
FGC11304
FGC11304
FGC11272
FGC11272
A12386
A12386
L627
L627
Z16540
Z16540
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies