Top » Catalog » SNPs » DF21

$18.00

DF21
[DF21]

DF21
hg38 Position: ChrY:10041306..10041306
Ancestral: C
Derived: T
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g
Comments: Beneath R-L21. upstream of DF5. Aka. rs138322855
Forward Primer: DF21_F TGTTGGCATCTTTACTACATCTGTATG
Reverse Primer: DF21_R AACCTGTGAAGAGTTAGATGTGACA
Reviews

Customers who bought this product also purchased
FGC5659
FGC5659
FGC5628
FGC5628
FGC5639
FGC5639
DC38
DC38
DC36
DC36
DC1
DC1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16670
1 x Y16323
$36.00
Haplogroup Info
Other products
Currencies