Top » Catalog » SNPs » DF21

$18.00

DF21
[DF21]

DF21
hg38 Position: ChrY:10041306..10041306
Ancestral: C
Derived: T
Reference: http://dna-forums.com/
ISOGG Haplogroup: R1b1a1a2a1a2c1g
Comments: Beneath R-L21. upstream of DF5. Aka. rs138322855
Forward Primer: DF21_F TGTTGGCATCTTTACTACATCTGTATG
Reverse Primer: DF21_R AACCTGTGAAGAGTTAGATGTGACA
Reviews

Customers who bought this product also purchased
Z2195
Z2195
BY13693
BY13693
A10499
A10499
FGC41901
FGC41901
CTS2457
CTS2457
A2121
A2121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies