Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
M172
M172
FGC11998
FGC11998
BY107550
BY107550
Z18092
Z18092
FGC12428
FGC12428
S9294
S9294
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies