Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
M173
M173
S47
S47
M269
M269
S1088
S1088
FGC5521
FGC5521
A178
A178
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies