Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
A275
A275
BY3647
BY3647
Y17161
Y17161
BY3550
BY3550
A12514
A12514
PF6645
PF6645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies