Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
Y62318
Y62318
Y156668
Y156668
V13
V13
M12036
M12036
BY42882
BY42882
BY39002
BY39002
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies