Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
A5411
A5411
L159.2
L159.2
Y22342
Y22342
Wish a SNP
Wish a SNP
S7449
S7449
S10067
S10067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies