Top » Catalog » SNPs » L21

$18.00

L21
[L21]

L21
hg38 Position: ChrY:13542548..13542548
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c
Comments: aka rs11799226
Forward Primer: L21_F GATAAGAAATGACAAAGGGCATTACG
Reverse Primer: L21_R TGTCATTATTTACCTGGAAGC
Reviews

Customers who bought this product also purchased
A5411
A5411
L159.2
L159.2
Y22342
Y22342
Wish a SNP
Wish a SNP
S10067
S10067
Z21280
Z21280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x B67
1 x BY73238
1 x A5360
1 x BY20673
1 x BY160474
1 x A24021
1 x FGC5939
1 x AM00687
1 x F2774
1 x CTS4050
1 x CTS3261
1 x CTS231
1 x ACT297
1 x BY1117
1 x AM00682
1 x A19129
1 x A15507
1 x FGC5943
1 x BY18408
1 x A14912
1 x CTS861
1 x BY10412
1 x A25756
1 x F3787
1 x AM00624
1 x BY1190
1 x BY36648
1 x A19151
1 x BY87188
1 x ACT1387
$540.00
Haplogroup Info
Other products
Currencies