Top » Catalog » SNPs » YP418

$18.00

YP418
[YP418]

YP418
hg38 Position: ChrY:7779691..7779691
Ancestral: A
Derived: T
Reference: Larence Mayka (2014)
ISOGG Haplogroup: R1a1a1b1a1b1 (not listed)
Comments: Subclade of YP417 which is a subclade of L1029
Forward Primer: YP418_F CATAGGAGAAAGACCTGGAATTG
Reverse Primer: YP418_R TTTTCTGGTGGAGGAAAGG
Reviews

Customers who bought this product also purchased
Y39054
Y39054
Y139228
Y139228
Y70897
Y70897
BY82741
BY82741
YP5081
YP5081
FT104863
FT104863
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies