Top » Catalog » SNPs » Z17619

$18.00

Z17619
[Z17619]

Z17619
hg38 Position: ChrY:8218081..8218081
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of L1335 > L1065 > Z16330
Forward Primer: Z17619_F GACATAAATAGTGTTATCCCAGGAGTC
Reverse Primer: Z17619_R ACATGCAGAACCTCTTTGCTG
Reviews (1)

Customers who bought this product also purchased
Z16325
Z16325
Z16331
Z16331
A1541
A1541
A1540
A1540
A1539
A1539
R1b-Z16330 downstream panel
R1b-Z16330 downstream panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies