Top » Catalog » SNPs » Z17619

$18.00

Z17619
[Z17619]

Z17619
hg38 Position: ChrY:8218081..8218081
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of L1335 > L1065 > Z16330
Forward Primer: Z17619_F GACATAAATAGTGTTATCCCAGGAGTC
Reverse Primer: Z17619_R ACATGCAGAACCTCTTTGCTG
Reviews (1)

Customers who bought this product also purchased
Z16325
Z16325
Z16331
Z16331
A1543
A1543
A1541
A1541
A1540
A1540
A1539
A1539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies