Top » Catalog » SNPs » ZS6589

$18.00

ZS6589
[ZS6589]

ZS6589
hg38 Position: ChrY:7325200..7325200
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC4474
Forward Primer: ZS6589_F CTACAGCCATGTCCTAACACCTAC
Reverse Primer: ZS6589_R AGGGCCCCGCCACAG
Reviews

Customers who bought this product also purchased
FGC5462
FGC5462
ZS6400
ZS6400
FGC4486
FGC4486
FGC5468
FGC5468
FGC5427
FGC5427
ZS3873
ZS3873
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies