Top » Catalog » SNPs » ZS6589

$18.00

ZS6589
[ZS6589]

ZS6589
hg38 Position: ChrY:7325200..7325200
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC4474
Forward Primer: ZS6589_F CTACAGCCATGTCCTAACACCTAC
Reverse Primer: ZS6589_R AGGGCCCCGCCACAG
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS3961
ZS3961
FGC4469
FGC4469
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
ZS6400
ZS6400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies