Top » Catalog » SNPs » FGC30918

$18.00

FGC30918
[FGC30918]

FGC30918
hg38 Position: ChrY:7359745..7359745
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > A431
Forward Primer: FGC30918_F AAATAATGAAGGAGAAACTCGGTAAGTAC
Reverse Primer: FGC30918_R TTAGCATCTAGGCTCTCCCG
Reviews

Customers who bought this product also purchased
Z225
Z225
A434
A434
U152
U152
Z2571
Z2571
Y7364
Y7364
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies