Top » Catalog » SNPs » FGC30918

$18.00

FGC30918
[FGC30918]

FGC30918
hg38 Position: ChrY:7359745..7359745
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > A431
Forward Primer: FGC30918_F AAATAATGAAGGAGAAACTCGGTAAGTAC
Reverse Primer: FGC30918_R TTAGCATCTAGGCTCTCCCG
Reviews

Customers who bought this product also purchased
Y7364
Y7364
P312
P312
Z296
Z296
A431
A431
L21
L21
R1b-DF27 Panel
R1b-DF27 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies