Top » Catalog » SNPs » FGC21495

$18.00

FGC21495
[FGC21495]

FGC21495
hg38 Position: ChrY:7779017..7779017
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G2a2b2a1a1a2a2
Comments: Below L1264
Forward Primer: FGC21495_F TTCAGATAGTGCTAGATTTCTTCTATACAGTAC
Reverse Primer: FGC21495_R TCCAATGACCCAAAAGGATG
Reviews

Customers who bought this product also purchased
L654.2
L654.2
FGC59713
FGC59713
Z44223
Z44223
Y32599
Y32599
L1264
L1264
Y87501
Y87501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies