Top » Catalog » SNPs » FGC21495

$18.00

FGC21495
[FGC21495]

FGC21495
hg38 Position: ChrY:7779017..7779017
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G2a2b2a1a1a2a2
Comments: Below L1264
Forward Primer: FGC21495_F TTCAGATAGTGCTAGATTTCTTCTATACAGTAC
Reverse Primer: FGC21495_R TCCAATGACCCAAAAGGATG
Reviews

Customers who bought this product also purchased
M201
M201
U8
U8
Y32607
Y32607
M172
M172
L140
L140
PH3992
PH3992
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies