Top » Catalog » SNPs » YSC0000261

$18.00

YSC0000261
[YSC0000261]

YSC0000261
hg38 Position: ChrY:12864559..12864559
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1a1a
Comments: Found in a hg I-L338 person (454 Y enrichment)
Forward Primer: YSC0000261_F CCACCAGGTCTTGGAATCAC
Reverse Primer: YSC0000261_R CTGCACTGGCCTCAAGATG
Reviews

Customers who bought this product also purchased
S12289
S12289
A1940
A1940
L338
L338
YSC0000260
YSC0000260
A5679
A5679
A1944
A1944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies