Top » Catalog » SNPs » YSC0000261

$18.00

YSC0000261
[YSC0000261]

YSC0000261
hg38 Position: ChrY:12864559..12864559
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1a1a
Comments: Found in a hg I-L338 person (454 Y enrichment)
Forward Primer: YSC0000261_F CCACCAGGTCTTGGAATCAC
Reverse Primer: YSC0000261_R CTGCACTGGCCTCAAGATG
Reviews

Customers who bought this product also purchased
S12289
S12289
FT68679
FT68679
A1940
A1940
A2404
A2404
L338
L338
A1934
A1934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies