Top » Catalog » SNPs » ZS7213

$18.00

ZS7213
[ZS7213]

ZS7213
hg38 Position: ChrY:2915132..2915132
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713 Aka Y16181
Forward Primer: ZS7213_F CCAGGGATGAAATAATGGTTC
Reverse Primer: ZS7213_R TTCAAGCCTGACTCCTCTGG
Reviews

Customers who bought this product also purchased
ZS7282
ZS7282
FT77163
FT77163
ZS5804
ZS5804
BY138887
BY138887
FGC23914
FGC23914
FGC1712
FGC1712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies