Top » Catalog » SNPs » ZS7213

$18.00

ZS7213
[ZS7213]

ZS7213
hg38 Position: ChrY:2915132..2915132
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713 Aka Y16181
Forward Primer: ZS7213_F CCAGGGATGAAATAATGGTTC
Reverse Primer: ZS7213_R TTCAAGCCTGACTCCTCTGG
Reviews

Customers who bought this product also purchased
ZS4717
ZS4717
Y16746
Y16746
FGC5427
FGC5427
FT77163
FT77163
ZS5804
ZS5804
ZS7282
ZS7282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies