Top » Catalog » SNPs » ZS7213

$18.00

ZS7213
[ZS7213]

ZS7213
hg38 Position: ChrY:2915132..2915132
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713 Aka Y16181
Forward Primer: ZS7213_F CCAGGGATGAAATAATGGTTC
Reverse Primer: ZS7213_R TTCAAGCCTGACTCCTCTGG
Reviews

Customers who bought this product also purchased
FGC1715
FGC1715
ZS9695
ZS9695
FGC11
FGC11
ZS5809
ZS5809
ZS8379
ZS8379
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies