Top » Catalog » SNPs » ZS7213

$18.00

ZS7213
[ZS7213]

ZS7213
hg38 Position: ChrY:2915132..2915132
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713 Aka Y16181
Forward Primer: ZS7213_F CCAGGGATGAAATAATGGTTC
Reverse Primer: ZS7213_R TTCAAGCCTGACTCCTCTGG
Reviews

Customers who bought this product also purchased
ZS8311
ZS8311
FGC5
FGC5
FGC1715
FGC1715
ZS9695
ZS9695
FGC11
FGC11
ZS5809
ZS5809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies