Top » Catalog » SNPs » A10951

$18.00

A10951
[A10951]

A10951
hg38 Position: ChrY:13353800..13353800
Ancestral: ins
Derived: del
Reference: Paul Mize (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10951_F TCAGTCATTCAACATGTCATTAAGG
Reverse Primer: A10951_R TCAAAGTTAGAGTCAATCCTCTTGAAC
Reviews

Customers who bought this product also purchased
A436
A436
A790
A790
A444
A444
A450
A450
A435
A435
A5581
A5581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies