Top » Catalog » SNPs » A455

$18.00

A455
[A455]

A455
hg38 Position: ChrY:21642891..21642891
Ancestral: A
Derived: G
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A455_F CAGATTATATCTGTATGCACTGAGTGC
Reverse Primer: A455_R AAGAATTGGTCACATATCTTTACGAC
Reviews

Customers who bought this product also purchased
A787
A787
Wish a SNP
Wish a SNP
Y15850
Y15850
A446
A446
A431
A431
A5579
A5579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies