Top » Catalog » SNPs » YFS1390487

$18.00

YFS1390487
[YFS1390487]

YFS1390487
hg38 Position: ChrY:21043431..21043431
Ancestral: G
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: YFS1390487_F GTCGCAGAAATAAACTGTAAGCTG
Reverse Primer: YFS1390487_R GCCAGAAAATGGCATGTTTG
Reviews

Customers who bought this product also purchased
YFS1390488
YFS1390488
A10887
A10887
A10892
A10892
A10899
A10899
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies