Top » Catalog » SNPs » YFS1390488

$18.00

YFS1390488
[YFS1390488]

YFS1390488
hg38 Position: ChrY:21309489..21309489
Ancestral: C
Derived: T
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: YFS1390488_F ACTCCACCTCCAGGGTTTAAG
Reverse Primer: YFS1390488_R CGATTACACCCACTTATTTGGTG
Reviews

Customers who bought this product also purchased
A10892
A10892
A10899
A10899
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10891
A10891
A10897
A10897
A10890
A10890
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies